br Materials and methods E

Materials and methods E. coli strains. Strains of E. coli with mutations in the lacZ gene for β-galactosidase [5] and a derivative with a knock-out mutation of the chromosomal gene for FPG produced with P1vir [6] were obtained from H. Schellhorn (McMaster Univ., Hamilton, Ontario, Canada). Growth on kanamycin confirmed the presence of the fpg::kan insertion. Plasmids. cDNAs were produced from mRNA templates of FPG variants in a flower mRNA library of Arabidopsis thaliana[7] as described [2]. Sequences of fpg-1 and fpg-2 cDNAs are registered as NCBI ID: AF099970 and AF099971, respectively. pTRC99a was obtained from Amersham Pharmacia Biotech, Inc. PCR copies of the cDNAs were inserted in the plasmid’s multiple cloning site to give pTRC99a::fpg-1, and pTRC99a::fpg-2 Like the expression plasmids described by [2], the PCR inserts were prepared with a N-terminal primer that used E. coli-preferred codons for the first six amino acids; unlike the expression plasmids, these inserts did not have poly-histidine C-terminal ends. Using the same mRNA library, a cDNA coding for OGG was prepared and inserted in pTRC99a to give pTRC99a::ogg. The cDNA sequence is NCBI ID: AJ277400[8]. Transformation. E. coli strains were transfected with pTRC99a or with pTRC99a containing cDNAs for FPG-1, FPG-2, or OGG by electroporation Single colonies were selected on Luria–Bertani broth [9] containing kanamycin and ampicillin. Mutation quantification. From overnight cultures, 1-ml cultures of each strain to be tested were diluted 1:100 and grown in Luria–Bertani broth at 37°C for six to eight hours to stationary phase. Of these cultures, 100μl were plated on 1.5% agar-solidified medium containing M9 salts (Gibco, BRL), 1mM MgSO4, 0.05mM CaSO4, and 0.2% lactose in 10-cm diameter plates. Plates were incubated at 37°C. The appearance of colonies was recorded daily. In each individual experiment, LacZ strains containing pTRC99a with an ogg or fpg insert were compared to a control with unmodified pTRC99a. The number of Crystal Violet used for inoculation, estimated by dilution and plating of one full set (six lacZ mutations, four plasmids), was analyzed by two-factor analysis of variance. There was no significant effect of plasmid type on the stationary-phase concentrations of cells (F3,15=0.46); however, the lacZ strains did show significant differences (F5,15=4.3, P<0.05; means±SD ranging from 2.6 (±0.4)×108 to 4.1 (±0.6)×108). In previous experiments, the number of cells on lactose plates was found not to increase significantly over the period of the experiment [10]. Accordingly, the mutation rates for cells plated on lactose were calculated using the inoculation values specific for each lacZ strain. For experiments in which cells were treated with UV radiation, 100μl of undiluted cultures were plated as described above on M9 medium containing lactose as carbon source. Each culture was also diluted appropriately and plated on M9 medium containing glucose. Pairs of plates (lactose and glucose) were irradiated together for 30s at 1.86Wm−2 with unfiltered radiation from a Hg-vapor lamp. Sequences of revertant lacZ genes. DNA from revertant colonies was extracted by heat treatment (95°C for 5min in 10μl of 10mM Tris, 1mM ethylenediaminetetraacetic acid buffer, pH 8; 20μl of water was added; and the suspension was centrifuged) and used as template in a polymerase chain reaction. With the primers, 5’CAAATAATATCGGTTGCGGAGGTG3′ and 5′AATATTGAAACCCACGGCATGGTG3′, amplification produced 250-bp fragments. These were isolated by gel electrophoresis, and their sequences were determined by the UC Davis College of Biological Sciences DNA Sequencing Center.
Results Fig. 1 compares the results for the fpg strains, HS1194 and HS1194(pTRC99a), with those for CSH104 (fpg+). Colonies started to appear two days after inoculation and continued to appear until at least day 6. As reported by Palmer et al. [6] and apparent in a comparison of results for HS1194 with CSH104, the inactivation of the endogenous fpg gene increased the rate of appearance of colonies in HS1194. Each colony could be attributed to a G→T transversion that led to mutant (revertant) lacZ and active β-galactosidase.